DNA 분류

5314187 상세정보
출처 DB BOLD SYSTEMS 출처 DB ID ITSAB3641-14 GenBank AJ548977
분류체계
학명 Plantago asiatica 전자도감 BHL NCBI EOL
Magnoliophyta > Magnoliopsida > Lamiales > Plantaginaceae > Plantago > Plantago asiatica
수집정보
국가 정보 없음 도/주 (Province) 정보 없음 시/군/구 (Region) 정보 없음 위도, 경도 정보 없음
서열 상세 정보
유전자명 ITS2 GenBank AJ548977 서열길이 (bp) 193
ACGCATCGCGTCGCCCCCTACACCAATTTGGTGAGGGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATCGATGGATGTCACAACCAGTGGTGGTTGAAAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTTGGGCATCGTTACAAAACAATGGTGCTAACGCGCCT